Search
the DNA database for Phycomyces DNA sequences
The genome of Phycomyces blakesleeanus has a length of about 40 Mbp with a guanine and
cytosine (G+C) content of 35%. Coding sequences are about 50% G+C and
the genome contains about 10% of repetitive DNA. Particularly
interesting is a short tandemly repeated sequence of 31 bp
(PrA) which is present in about 5% of the genome.
PrA
sequences can be distributed into several families; a typical
sequence is the following:
TATATATATATAAGTCCATGACAGCTGATCTGG
Accession number Z58821
More details about the Phycomyces genome can be found in the following paper:
Avalos,J.,
Corrochano,L.M. and Brenner,S. "Genomic organization of the fungus
Phycomyces" Gene 174 (1), 43-50 (1996).
Phycomyces genome project: The updated information can be obtained in this web page.
Phycomyces codon usage
TTT phe 184 TCT ser 196 TAT tyr 114 TGT cys 89 TTC phe 238 TCC ser 159 TAC tyr 218 TGC cys 77 TTA leu 42 TCA ser 93 TAA --- 10 TGA --- 1 TTG leu 173 TCG ser 67 TAG --- 1 TGG trp 126 CTT leu 208 CCT pro 193 CAT his 95 CGT arg 216 CTC leu 244 CCC pro 192 CAC his 139 CGC arg 128 CTA leu 36 CCA pro 95 CAA gln 128 CGA arg 44 CTG leu 148 CCG pro 36 CAG gln 209 CGG arg 21 ATT ile 268 ACT thr 209 AAT asn 124 AGT ser 81 ATC ile 338 ACC thr 260 AAC asn 275 AGC ser 83 ATA ile 23 ACA thr 116 AAA lys 126 AGA arg 61 ATG met 269 ACG thr 26 AAG lys 435 AGG arg 5 GTT val 257 GCT ala 315 GAT asp 293 GGT gly 332 GTC val 302 GCC ala 328 GAC asp 243 GGC gly 132 GTA val 85 GCA ala 170 GAA glu 295 GGA gly 164 GTG val 103 GCG ala 25 GAG glu 258 GGG gly 31
The table has been computed using the genes facA, pyrG, leu1, trp1, carB, pkpA, chs1, hmgR, hmgS, carRA, pilD, and a group of fragments of Phycomyces genes available in the database. A total of 9952 codons.
updated 2003.09.26
The updated codon usage table for complete genes can be viewed here
main
page - life cycle - genome - photoresponses - abstracts - directory - Delbrück - web sites